Review



tlcv2 loxp plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc tlcv2 loxp plasmid
    Tlcv2 Loxp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pmc12662214-234-1-9
    Average 93 stars, based on 4 article reviews
    tlcv2 loxp plasmid - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment
    Article Snippet: ANXA4 in pWPXLd , This study; swap cloning from existing plasmid , N/A. .. TLCV2-LoxP , Adam Karpf Lab (unpublished) , Addgene plasmid #127098, RRID:Addgene_127098. ..

    Article Title: Fibroblast growth factor receptor signaling modulates cholesterol storage in a SOAT1-dependent manner to promote mammary tumor cell invasion.
    Article Snippet: .. TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; h t t p : / / n 2 t . n e t / a d d g e n e : 1 2 7 0 9 8; RRID: Addgene_127098). ..

    Article Title: Fibroblast growth factor receptor signaling modulates cholesterol storage in a SOAT1-dependent manner to promote mammary tumor cell invasion
    Article Snippet: .. TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098 ; RRID: Addgene_127098). ..



    Similar Products

    tlcv2 loxp plasmid  (Addgene inc)
    93
    Addgene inc tlcv2 loxp plasmid
    Tlcv2 Loxp Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pmc12662214-234-1-9
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp plasmid - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    tlcv2 loxp  (Addgene inc)
    93
    Addgene inc tlcv2 loxp
    Tlcv2 Loxp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pm40665359-116-0-7
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    adam karpf  (Addgene inc)
    93
    Addgene inc adam karpf
    Adam Karpf, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pm40665359-116-5-7
    Average 93 stars, based on 1 article reviews
    adam karpf - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    addgene plasmid  (Addgene inc)
    93
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pmc11982489-92-7-7
    Average 93 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    tlcv2 loxp backbone  (Addgene inc)
    93
    Addgene inc tlcv2 loxp backbone

    Tlcv2 Loxp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tlcv2+loxp/TLCV2-LoxP+(Plasmid+%23127098)/pmc11982489-403-26-35
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp backbone - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098).

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture